{
	"info": {
		"_postman_id": "a3f7e7e8-9571-49ac-80b9-180fd01bb47b",
		"name": "Scitools+ API",
		"schema": "https://schema.getpostman.com/json/collection/v2.1.0/collection.json"
	},
	"item": [
		{
			"name": "Authentication",
			"item": [
				{
					"name": "authentication svc",
					"request": {
						"auth": {
							"type": "basic",
							"basic": [
								{
									"key": "password",
									"value": "<Client Secret>",
									"type": "string"
								},
								{
									"key": "username",
									"value": "<ClientId>",
									"type": "string"
								}
							]
						},
						"method": "POST",
						"header": [
							{
								"key": "Content-Type",
								"name": "Content-Type",
								"value": "application/x-www-form-urlencoded",
								"type": "text"
							},
							{
								"key": "",
								"value": "",
								"type": "text",
								"disabled": true
							}
						],
						"body": {
							"mode": "urlencoded",
							"urlencoded": [
								{
									"key": "grant_type",
									"value": "password",
									"type": "text"
								},
								{
									"key": "username",
									"value": "<LoginName>",
									"description": "login name of your IDT web account",
									"type": "text"
								},
								{
									"key": "password",
									"value": "<Password>",
									"description": "password of your IDT web account",
									"type": "text"
								},
								{
									"key": "scope",
									"value": "test",
									"type": "text"
								}
							]
						},
						"url": {
							"raw": "https://www.idtdna.com/Identityserver/connect/token",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"Identityserver",
								"connect",
								"token"
							]
						},
						"description": "OAUTH service.  Takes in authentication data and returns a bearer token, for use in authenticating subsequent API calls."
					},
					"response": []
				}
			],
			"protocolProfileBehavior": {}
		},
		{
			"name": "Calculators",
			"item": [
				{
					"name": "OligoAnalyzer - Analyze",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "POST",
						"header": [
							{
								"key": "Content-Type",
								"name": "Content-Type",
								"value": "application/json",
								"type": "text"
							}
						],
						"body": {
							"mode": "raw",
							"raw": "{\"Sequence\":\"AGAGAGAGAGAGAGAGAG\",\"NaConc\":50,\"MgConc\":0,\"DNTPsConc\":0,\"OligoConc\":0.25,\"NucleotideType\":\"DNA\"}"
						},
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/OligoAnalyzer/Analyze",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"OligoAnalyzer",
								"Analyze"
							]
						}
					},
					"response": []
				},
				{
					"name": "OligoAnalyzer - Hairpin",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "POST",
						"header": [
							{
								"key": "Content-Type",
								"value": "application/json",
								"type": "text"
							}
						],
						"body": {
							"mode": "raw",
							"raw": "{\r\n  \"Sequence\": \"AGAGAGAGAGAGAGAGAG\",\r\n  \"NaConc\": 50,\r\n  \"FoldingTemp\": 100,\r\n  \"MgConc\": 0,\r\n  \"NucleotideType\": \"DNA\"\r\n}"
						},
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/OligoAnalyzer/Hairpin",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"OligoAnalyzer",
								"Hairpin"
							]
						}
					},
					"response": []
				},
				{
					"name": "OligoAnalyzer - HeteroDimer",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "POST",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/OligoAnalyzer/HeteroDimer?primary=<primary DNA sequence>&secondary=<secondary DNA sequence>",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"OligoAnalyzer",
								"HeteroDimer"
							],
							"query": [
								{
									"key": "primary",
									"value": "<primary DNA sequence>",
									"description": "DNA sequence  eg. AGAGAGAGAGAGAGAGAG "
								},
								{
									"key": "secondary",
									"value": "<secondary DNA sequence>",
									"description": "DNA sequence  eg. TCTCTCTCTCTCTCTCTC"
								}
							]
						}
					},
					"response": []
				},
				{
					"name": "OligoAnalyzer - TmMismatch",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "POST",
						"header": [],
						"body": {
							"mode": "raw",
							"raw": "{\r\n  \"Settings\": {\r\n    \"Sequence\": \"ACACACACACACACACAC\",\r\n    \"NaConc\": 50,\r\n    \"MgConc\": 50,\r\n    \"dNTPsConc\": 50,\r\n    \"OligoConc\": 50\r\n  },\r\n  \"Sequence2\": \"GTGTGTGTGTGTGTGTGTGT\"\r\n}"
						},
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/OligoAnalyzer/TmMisMatch",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"OligoAnalyzer",
								"TmMisMatch"
							]
						}
					},
					"response": []
				},
				{
					"name": "Complexity - ScreenGblockSequences",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "POST",
						"header": [
							{
								"key": "Content-Type",
								"type": "text",
								"value": "application/json"
							}
						],
						"body": {
							"mode": "raw",
							"raw": "[{\"Name\":\"My gBlock2\",\"Sequence\":\"CTGGAACTGGCGCTTAAAGCGCTGCAGATTCTGGTGAACGCCGCCTACGTGCTGGCGGAGATTGCGAGGGATCGCGGCAATGAAGAACTGCTGGAGAAAGCGGCGCGCCTGGCAGAAGAAGCGGCACGCCAGGCGGAAGAAATCGCGCGTCAGGCGCGCAAAGAAGGCAATCTGGAGTTGGCCCTGAAAGCCCTTCAGATTCTTGTGAATGCCGCGTATGTTCTGGCCGAAATTGCGCGTGATCGCGGTAATGAAGAGTTGCTTGAAAAAGCCGCGCGTCTGGCTGAGGAGGCAGCGCGACAAGCAGAAGAAATAGCGCGCCAGGCCCGCAAGGAAGGGAACCTTGAACTGGCCCTCAAAGCGTTGCAAATCCTGGTCAATGCGGCATATGTGTTAGCAGAAATTGCGCGCGATCGGGGGAACGAGGAGCTGTTAGAAAAAGCGGCCCGTCTTGCAGAAGAAGCCGCCCGGCAGGCGGAAGAAATTGCGCGGCAGGCACGGAAAGAAGGAAACTTAGAACTGGCACTGAAGGCCCTGCAAATTCTGGTAAACGCGGCGTACGTCCTTGCTGAAATTGCGCGAGATCGAGGTAACGAAGAGCTTCTGGAAAAAGCGGCTCGCCTTGCCGAGGAAGCCGCTCGCCAGGCAGAGGAGATTGCGCGTCAGGCTCGGAAAGAGGGCAATTTGGAACTGGCGTTGAAAGCATTACAGATTTTGGTTAACGCAGCCTACGTACTCGCTGAAATTGCGCGGGATAGAGGCAACGAAGAACTACTGGAAAAAGCAGCCCGCTTAGCTGAAGAAGCAGCTCGCCAGGCTGAAGAAATTGCTAGACAGGCGAGAAAAGAAGGGAATCTTGAATTGGCATTAAAAGCTCTACAGATTCTCGTCAACGCGGCCTATGTCCTGGCTGAAATTGCCAGAGATCGTGGCAATGAAGAACTTTTAGAGAAGGCGGCCAGACTGGCTGAAGAAGCTGCGCGTCAGGCGGAAGAAATTGCCCGCCAGGCGCGGAAGGAGGGTAACCTCGAGCTGGCCTTAAAAGCCTTACAGATCTTAGTGAATGCGGCTTATGTTTTGGCTGAGATCGCCCGTGACAGGGGAAACGAAGAACTCCTCGAAAAAGCTGCCCGGTTAGCGGAAGAGGCTGCTCGCCAGGCGGAAGAGATTGCACGGCAAGCGCGTAAAGAAGGCAACTTGGAACTGGCTTTAAAAGCACTGCAGATACTAGTGAACGCAGCGTATGTACTGGCTGAAATTGCACGCGATAGGGGTAATGAGGAATTGTTGGAAAAGGCTGCGCGCTTGGCGGAAGAAGCTGCTAGGCAAGCTGAAGAAATTGCCCGTCAAGCACGTAAAGAAGGTAATCTCGAATTAGCTCTGAAAGCTTTACAAATTTTAGTTAATGCAGCATACGTTCTCGCGGAAATTGCTCGTGACCGTGGTAATGAAGAATTATTGGAGAAGGCTGCACGTTTAGCCGAAGAAGCTGCAAGACAAGCGGAGGAAATCGCACGTCAAGCCCGTAAGGAAGGCAAC\n\n\"}]"
						},
						"url": {
							"raw": "https://www.idtdna.com/api/complexities/screengBlockSequences",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"api",
								"complexities",
								"screengBlockSequences"
							]
						}
					},
					"response": []
				},
				{
					"name": "CodonOptimization - Optimize",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "POST",
						"header": [
							{
								"key": "Content-Type",
								"value": "application/json",
								"type": "text"
							}
						],
						"body": {
							"mode": "raw",
							"raw": "{\r\n  \"organism\": \"Mus musculus (mouse)\",\r\n  \"optimizationItems\": [\r\n    {\r\n      \"Name\": \"testname\",\r\n      \"Sequence\": \"acgacgtacgatcgatcgatcgatcgatcgatc\"\r\n    }\r\n  ],\r\n  \"sequenceType\": \"dna\",\r\n  \"productType\": \"megamer\"\r\n}"
						},
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/CodonOpt/Optimize",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"CodonOpt",
								"Optimize"
							]
						}
					},
					"response": []
				},
				{
					"name": "CodonOptimization - Organisms",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/CodonOpt/Organisms",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"CodonOpt",
								"Organisms"
							]
						}
					},
					"response": []
				},
				{
					"name": "CodonOptimization - ProductTypes",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/CodonOpt/ProductTypes",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"CodonOpt",
								"ProductTypes"
							]
						}
					},
					"response": []
				},
				{
					"name": "CodonOptimization - SequenceTypes",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/CodonOpt/SequenceTypes",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"CodonOpt",
								"SequenceTypes"
							]
						}
					},
					"response": []
				}
			],
			"protocolProfileBehavior": {}
		},
		{
			"name": "OligoCard",
			"item": [
				{
					"name": "OligoCards",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/OligoCard",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"OligoCard"
							]
						}
					},
					"response": []
				},
				{
					"name": "Card Details",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/OligoCard/<CardID>",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"OligoCard",
								"<CardID>"
							]
						}
					},
					"response": []
				}
			],
			"protocolProfileBehavior": {}
		},
		{
			"name": "Order/Item data",
			"item": [
				{
					"name": "Order Details - all",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/SalesOrders/",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"SalesOrders",
								""
							]
						}
					},
					"response": []
				},
				{
					"name": "Order Details - by order",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/SalesOrders/<SalesOrderID>",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"SalesOrders",
								"<SalesOrderID>"
							]
						}
					},
					"response": []
				},
				{
					"name": "Order Details - QC Document",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/QC/DownloadZip/<SalesOrderID>",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"QC",
								"DownloadZip",
								"<SalesOrderID>"
							]
						}
					},
					"response": []
				},
				{
					"name": "Order Details - Shipment status",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/Shipment/<ShipmentID>",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"Shipment",
								"<ShipmentID>"
							]
						}
					},
					"response": []
				},
				{
					"name": "Item Details - by order",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/SalesOrders/<SalesOrderID>/LineItems",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"SalesOrders",
								"<SalesOrderID>",
								"LineItems"
							]
						}
					},
					"response": []
				},
				{
					"name": "Item Details - by item",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/SalesOrders/Lineitems/<ItemRefID>",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"SalesOrders",
								"Lineitems",
								"<ItemRefID>"
							]
						}
					},
					"response": []
				},
				{
					"name": "Item Details - Manufacturing Spec Document",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/salesorders/Specs/pdf/<ItemMfgID>",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"salesorders",
								"Specs",
								"pdf",
								"<ItemMfgID>"
							]
						}
					},
					"response": []
				},
				{
					"name": "Invoice - all",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/Invoices",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"Invoices"
							]
						}
					},
					"response": []
				},
				{
					"name": "Invoice - individual",
					"request": {
						"auth": {
							"type": "bearer",
							"bearer": [
								{
									"key": "token",
									"value": "<Bearer Token from Authentication service call>",
									"type": "string"
								}
							]
						},
						"method": "GET",
						"header": [],
						"url": {
							"raw": "https://www.idtdna.com/restapi/v1/Invoices/<InvoiceID>",
							"protocol": "https",
							"host": [
								"www",
								"idtdna",
								"com"
							],
							"path": [
								"restapi",
								"v1",
								"Invoices",
								"<InvoiceID>"
							]
						}
					},
					"response": []
				}
			],
			"protocolProfileBehavior": {}
		}
	],
	"auth": {
		"type": "oauth2",
		"oauth2": [
			{
				"key": "accessToken",
				"value": "c986e4cd9586022d4189aaa5f39dfcec",
				"type": "string"
			},
			{
				"key": "tokenType",
				"value": "Bearer",
				"type": "string"
			},
			{
				"key": "addTokenTo",
				"value": "header",
				"type": "string"
			}
		]
	},
	"event": [
		{
			"listen": "prerequest",
			"script": {
				"id": "4c9db4c7-78c0-41f5-ad23-290b62f01b2d",
				"type": "text/javascript",
				"exec": [
					""
				]
			}
		},
		{
			"listen": "test",
			"script": {
				"id": "ecc7841a-6b61-404f-8da7-00a36d84a4db",
				"type": "text/javascript",
				"exec": [
					""
				]
			}
		}
	],
	"protocolProfileBehavior": {}
}